ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Biodiversity Bioinformatics Summer School
31 March 2026
02 April 2026
A but lucratif : 1900 CHF
Aucune instance future de ce cours n'est prévue pour l'instant
This School is co-organized by SIB/ELIXIR Switzerland and de.NBI/ELIXIR Germany
Overview
Biodiversity is fundamental to ecosystem functioning, yet it is facing unprecedented pressure. Advances in the generation, analysis and integration of omics data by bioinformatics tools are transforming our ability to study biodiversity across scales through comprehensive, high-throughput molecular profiling of organisms and ecosystems. This summer school aims to equip life scientists with extended knowledge and practical skills to address these challenges.
It will follow a hackathon / mini-project format, with around 20 hours dedicated to hands-on training and collaborative problem-solving. Each participant will work within a single group throughout the week, fostering deep engagement, collaborative problem-solving, and the exchange of knowledge and expertise. Experienced trainers will guide four groups, focusing on the following topics:
- Biodiversity across scales – from eDNA to ecosystems
- Pangenomes: Capturing genetic diversity beyond a single reference
- Computing genomic essential biodiversity variables
- Evolutionary and functional insights from large-scale comparative genomics
To complement the project work, the programme will include lectures and a social activity. Participants will stay together in a comfortable hotel, creating an environment that encourages informal exchanges and networking beyond the formal sessions. Accommodation and meals are included in the registration fee, allowing participants to focus entirely on training, collaboration, and community building.
Topic 1: Biodiversity across scales – from eDNA to ecosystems
This project introduces the background and conceptual foundations of environmental DNA (eDNA) metabarcoding as a powerful tool for biodiversity assessment. Participants will gain a theoretical overview of key laboratory steps, from sample processing to sequencing, and explore different bioinformatic pipelines that transform raw sequencing reads into taxonomic lists and ecological diversity metrics. Emphasis is placed on understanding methodological choices, sources of bias, and best practices across workflows. The project is designed as a hands-on training, guiding participants step by step from raw sequencing data to interpretable biodiversity results. Each participant will build and run their own analysis pipeline, enabling a practical understanding of metabarcoding data generation and analysis. The course concludes by highlighting ecological and applied use cases of metabarcoding in biodiversity research and monitoring.
Trainers
Dr Vera Zizka, The State Museum of Natural History, Karlsruhe
Dr Ameli Kirse, Leibniz Institute for the Analysis of Biodiversity Change
Skills/experience needed for this topic
-basic command line experience
-basic R software experience
-basic knowledge in molecular sequencing data
Topic 2: Capturing genetic diversity beyond a single reference
In this project, participants will experience the fundamental workflow of genomic analysis, beginning with the quality assessment and de novo assembly of raw sequencing reads. Participants will proceed to characterize the obtained genome assemblies through structural and functional gene annotation, followed by variant calling to identify specific genetic differences. The project concludes with the construction of a graph-pangenome to model the full scope of genetic diversity within a population.
Trainers
Dr Marie Bolger, Forschungszentrum Jülich
Dr Sebastian Beier, Forschungszentrum Jülich,
Skills/experience needed for this topic
-basic command line experience
-some experience with sequencing technologies and associated data formats (eg., fasta, fastq, vcf)
Topic 3: Computing genomic essential biodiversity variables
Essential Biodiversity Variables (EBVs) are a set of standardized biological measurements designed to quantify and report changes in biodiversity across time, space, and biological levels, with the goal of informing and influencing policy‑making decisions. In this project, participants will work in small groups to design and carry out a biodiversity genomics analysis aimed at quantifying EBVs. Starting from a conservation or management question, they will use publicly available genomic datasets and develop an analysis plan, spanning raw data quality control, read mapping, and variant calling, through to population structure, diversity, inbreeding, and effective population size metrics.
The project emphasizes reproducible pipeline design using established tools, standard reference resources, and careful interpretation of EBV outputs in the context of conservation, bioeconomy, and policy-making.
Trainers
Dr Tristan Cumer, Department of Ecology and Evolution, University of Lausanne, Switzerland
Dr Chiara Bortoluzzi anb Dr Christian de Guttry, Environmental Bioinformatics, SIB Swiss Institute of Bioinformatics
Skills/experience needed for this topic
-basic command line experience
-basic R software experience
Nice to have:
-prior experience with sequencing technologies and associated data formats (e.g., FASTA, FASTQ, VCF) would be beneficial
-basic understanding of population genetics may be helpful
Topic 4: Evolutionary and functional insights from large-scale comparative genomics
In this project, participants will work in small groups to design and carry out a comparative genomics study addressing an evolutionary or functional question. Starting from a biological question, they will identify relevant datasets, plan appropriate analyses (e.g. genome quality control, orthology inference, gene family evolution, functional annotation), and implement them using existing tools and resources. The project emphasizes methodological choices, data interpretation, and critical evaluation of results. Results will be synthesized and presented at the end of the week.
Trainers
Dr Natasha Glover, Comparative Genomics Group, University of Lausanne and SIB Swiss Institute of Bioinformatics
Dr Robert Waterhouse, Environmental Bioinformatics group, SIB Swiss Institute of Bioinformatics
Skills/experience needed for this topic
-basic command line experience
-basic familiarity with at least one scripting language (Python or R)
-general understanding of genomics concepts (genes, genomes, annotations)
Nice to have:
-prior exposure to comparative genomics concepts (orthology, gene families, synteny)
-experience working with omics data (genomics, transcriptomics)
-familiarity with bioinformatics workflows or pipelines
-basic data visualization skills (R, Python, or similar)
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who are interested in biodiversity bioinformatics.
Learning outcomes
At the end of the course, the participants are expected to:
- understand the major challenges of biodiversity bioinformatics
- have gained an in-depth knowledge of the topic in which they participated
- have played an active role in a group project and delivered a presentation of the results.
Prerequisites
Knowledge / competencies
This course is designed for beginner to intermediate users, and requires the following general skills/experience:
- Previous experience with sequencing technologies and associated data formats (eg., fasta, fastq, vcf)
- Basic command-line usage (Linux/Unix)
- Basic familiarity with at least one scripting language (Python or R)
More specific prerequisites are listed in the topics paragraphs above.
Technical
Participants are required to bring their own laptop with administrative rights, allowing them to install software and/or packages during the course if needed. However, we expect all required software—details of which will be communicated later—to be installed prior to the course.
Schedule - CET time zone
Note that the details of the schedule are informative, changes are possible.
Sunday
~18h00 Arrival and registration
19h00 Dinner
20h15 Welcome session
Monday
09h00 General introduction + introduction to the 4 topics
10h30 Break
11h00 Introduction to the 4 topics and/or Project work in groups
12h30 Lunch
14h00 Project work in groups (including a break)
17h15 Recap of the day
17h30 End
Tuesday
09h00 Project work in groups
10h30 Break
11h00 Lecture
11h45 Project work in groups
12h30 Lunch
14h00 Project work in groups (including a break)
17h15 Recap of the day
17h30 End
Wednesday
09h00 Project work in groups
10h30 Break
11h00 Lecture
11h45 Project work in groups
12h30 Lunch
14h00 Social Activity
17h15 Recap of the day
17h30 End
Thursday
09h00 Project work in groups
10h30 Break
11h00 Lecture
11h45 Project work in groups
12h30 Lunch
14h00 Project work in groups + project presentation preparation (including a break)
17h15 Recap of the day
17h30 End
Friday
09h00 Project presentations
10h30 Break
11h00 Project presentations
11h45 Conclusion
12h00 Lunch & back home
Application
The registration fees for academics are 900 CHF (~950 EUR) and 1900 CHF (~2000 EUR) for for-profit companies. Course fees and hotel accommodation (in single rooms), as well as meals are included.
Applicants will be contacted by email after submitting their application and invited to provide a motivation letter and complete a short survey to let us know about your topic preference(s). In the event of oversubscription, participants will be selected based on several criteria, which may extend the time required to confirm registration.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 10 days.
Applications will close on 31 March 2026. Deadline for free-of-charge cancellation is set to 2 April 2026. Any cancellation after this date may be subject to penalties, depending on the possibility of replacement by someone in the waiting list.
Summary of the process:
- application using the button at the top of the page
- you receive an email containing instructions to send back a motivation letter and to complete a survey to let us know your preference(s)
- validation of your participation or placed on a waiting list
- payment
Venue and Time
The course will take place at the Dorint Parkhotel Siegen in Germany.
To ensure every participant easy traveling, the school will start on Sunday around 19h and end on Friday after lunch.
Precise information will be provided to the registered participants in due time.
Additional information
Coordination: Helena Schnitzer (de.NBI and ELIXIR Germany) and Grégoire Rossier (SIB).
At the end of the course, we will provide a Certificate of Achievement recommending 2 ECTS credits.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact us.