ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
SARS-Coronavirus-2 data in ViralZone - now on YouTube
13 April 2020
13 April 2020
A but lucratif : 0 CHF
Aucune instance future de ce cours n'est prévue pour l'instant
Overview
ViralZone is a SIB Swiss Institute of Bioinformatics web resource for all viral genera and families, providing general molecular and epidemiological information, along with virion and genome figures.
This course explains — and demonstrates — how to access the freely available, high quality data on SARS-CoV-2 in ViralZone, presents the latest knowledge on coronavirus, and how this information can be used.
The ViralZone project is handled by the SwissProt group. This course is taught by Philippe Le Mercier, virologist and ViralZone team leader. Philippe has already lectured at SIB several times.
Structure
A tour of the data on SARS-CoV-2 found in ViralZone will be presented.
This will be followed by a Question and Answer (Q&A) session.
Audience
PhD students, postdocs and other researchers, from any scientific environment (academia, facilities, companies, etc.) interested in COVID-19 data.
This course should be of interest to any researcher who aims to use viral genome data, including purely experimental researchers. It will be of particular interest to biologists and bioinformatic researchers that analyze viral genome data in their work.
Learning objectives
At the end of this course, the participants will be able to:
- Access the data on coronavirus in ViralZone.
- Understand the current knowledge on coronavirus.
- Use the data provided.
- Understand publicly available viral data.
Prerequisites
Knowledge / competencies
The ViralZone resource is web-based. No particular bioinformatics competencies are required.
Knowledge of the basic molecular biology of viruses is presumed.
Participants may wish to view the following YouTube videos:
Technical
This course will be streamed, you are thus required to have your own computer with an internet connection.
Venue and Time
This course will be streamed to registered participants, and more information will be sent in due time.
The course will start at 9:00 CET and end around 10:00 CET.
Application
Attendance is free-of-charge, however registration is mandatory.
You will be informed by email of your registration confirmation.
Additional information
Coordination: Monique Zahn
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
For more information, please contact training@sib.swiss.