ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG


Chip-seq data analysis: from quality check to motif discovery and more - An introduction to the tools and databases of the EPD team
02 April 2018
A but lucratif : 0 CHF
Aucune instance future de ce cours n'est prévue pour l'instant
Overview
This is a course on bioinformatics resources taught by the developers of the resources. Participants will learn how to analyze their own or public ChIP-seq data using tools from the ChIP-seq, Signal Search Analysis (SSA) and PWMtools servers in conjunction with the Eukaryotic Promoter Database (EPD) and external regulatory bioinformatics tools.
Learning objectives
After the course, participants should:
- have a thorough understanding of the methods of ChIP-seq data analysis and DNA motif-based gene regulatory region analysis
- be proficient in the usage of our bioinformatics tools
- be able to interpret results obtained with our tool
- have gained ample practical experience in working with public NGS-based functional genomics data.
Prerequisites
Knowledge / competencies:
Participants should have a good understanding of molecular biology and functional genomics. Most of the exercises are web-based. Basic knowledge of R is required for some exercises, please visit our tutorial here.
Technical:
A WiFi-equipped laptop with at least 30 GB free hard-disk space.
Application
The registration fees are 300 CHF for academics and 1500 CHF for for-profit companies. This includes course content material, coffee breaks and social dinner.
Deadline for application and free-of-charge cancellation is set to 2 April. Cancellation after this date will not be reimbursed.
Please note that participation to SIB courses is subject to our general conditions, available here.
You will be informed by email of your registration confirmation.
Venue and time
University of Lausanne
The course will start at 9:00 and end around 17:00. Precise information will be provided to the participants on due time.
Additional information
We will recommend 2 ECTS credits (40 hours lessons/practical + 20 hours paper preparation / presentation).
Coordination: Patricia Palagi
You are welcome to register to the SIB courses mailing-list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
For more information, please contact training@sib.swiss.