ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Data security

Browse our projects and discoveries on the topic

coronaviruses in the world

Switzerland establishes a national infrastructure to track COVID-19 and its variants

13 October 2021

Today, the delta variant of the virus dominates the Swiss landscape. This is...

a man is looking at a screen showing a map of Switzerland with data interoperability path

How to make biomedical research data able to interact?

coronaviruses in the world

Accelerating global COVID-19 research with a Swiss SARS-CoV-2 Data Hub

Over the past weeks and with the threat of emerging variants growing, pressing...

The SPHN fact-sheet 2020 is out

13 November 2020

Find out about the current status of the Swiss Personalized Health Network (SPHN...

Smart doctor hand working with modern laptop computer in modern office with virtual icon diagram

How SIB is securing sensitive data for health-related research

As part of its infrastructure activities, SIB is in charge of BioMedIT , a...

Latest SIB Profile: explore a year of Swiss bioinformatics

vector illustration of a group of doctors and medical equipment around a table

Bringing Swiss health data to biomedical research: an interoperability journey

04 September 2019

Health data from patients are typically generated and stored in a multitude of...

an image of a network of red and white dots

"The network we are building to empower personalized health research will be here to last"

Personalized healthcare requires a solid foundation; establishing...

Upcoming related training

Services

Training

Scientific training

Acquire skills to make the most out of the latest advances in bioinformatics and data science.

Community

Our groups

Find out more about our experts both at the SIB Hub and institutions across Switzerland.

Our support functions

What's on

About

Find out what drives us, our mission, identity and history over the years.