ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Introduction to bulk RNA-Seq: From Quality Control to Pathway Analysis
25 November 2019
For-profit: 600 CHF
Next course(s):
05 - 06 Oct 2020 | Streamed | |
02 - 03 Sep 2021 | Streamed | |
01 - 02 Sep 2022 | Basel | |
19 - 20 Sep 2023 | Basel | |
19 - 20 Sep 2024 | Zürich |
This course is currently over-subscribed with a waiting list.
Overview
This two-day course will present the theory and bioinformatics tools required to analyze RNA-seq gene expression data, from the raw data to the biological interpretation. The following topics will be discussed:
- Quality control
- Mapping to genomes & transcriptomes
- Read counting, gene & exons differential expression analysis
- GO enrichment and pathway analysis
Audience
This course is intended for life scientists or bioinformaticians familiar with "Next Generation Sequencing" who wish to acquire the necessary skills to analyse RNA-seq gene expression data.
Learning objectives
At the end of the course attendees will:
- Understand advantages and pitfalls of RNA sequencing
- Be able to design their own experiment
- Practise the downstream analysis using command line software (QC, mapping, counting, differential expression analysis, pathway analysis, etc)
Prerequisites
Knowledge / competencies: Participants should already have a basic knowledge in Next Generation Sequencing (NGS) techniques or already followed the Introduction to NGS course. A basic knowledge of the R statistical software and completion of an introductory course on UNIX (eg UNIX fundamentals) or equivalent knowledge is also required.
Location & Time
University of Basel, Kollegienhaus, Petersgraben 50, 4051 Basel
The course will start at 9:00 and end around 17:00. Precise information will be provided to the participants on due time.Application
The registration fees for academics are 120 CHF and 600 CHF for participants from industry. This includes course content material and coffee breaks.
Please note that participation to SIB courses is subject to this and other general conditions, available here.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Additional information
You are welcome to register to the SIB courses mailing-list to be informed when the applications for this course will be open, of all future courses and workshops, as well as all important deadlines using the form here.
For more information, please contact training@sib.swiss.