ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Chip-seq data analysis: from quality check to motif discovery and more - An introduction to the tools and databases of the EPD team
15 March 2017
For-profit: 0 CHF
No future instance of this course is planned yet
Overview
This is a course on bioinformatics resources taught by the developers of the resources. Participants will learn how to analyze their own or public ChIP-seq data using tools from the ChIP-seq, Signal Search Analysis (SSA) and PWMtools servers in conjunction with the Eukaryotic Promoter Database (EPD) and external regulatory bioinformatics tools.
Learning objectives
After the course, participants should:
- have a thorough understanding of the methods of ChIP-seq data analysis and DNA motif-based gene regulatory region analysis
- be proficient in the usage of our bioinformatics tools
- be able to interpret results obtained with our tool
- have gained ample practical experience in working with public NGS-based functional genomics data.
Prerequisites
Knowledge / competencies:
Participants should have a good understanding of molecular biology and functional genomics. Most of the exercises are web-based. Basic knowledge of R is required for some exercises, please visit our tutorial here.
Technical:
A WiFi-equipped laptop with at least 30 GB free hard-disk space.
Application
The registration fees for academics are 200 CHF. This includes course content material and coffee breaks. Participants from non-academic institutions should contact us before application.
Deadline for application and free-of-charge cancellation is set to 15 March. Cancellation after this date will not be reimbursed.
Please note that participation to SIB courses is subject to our general conditions, available here.
You will be informed by email of your registration confirmation.
Location
University of Lausanne, Génopode building, classroom 2020 (Metro M1 line, Sorge station).
Additional information
We will recommend 2 ECTS credits (40 hours lessons/practical + 20 hours paper preparation / presentation).
Coordination: Grégoire Rossier
You are welcome to register to the SIB courses mailing-list to be informed of all future courses and workshops, as well as all important deadlines using the form here.