ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
RNA-sequencing: From quality control to pathway analysis
04 February 2016
For-profit: 0 CHF
No future instance of this course is planned yet
Overview
This course will present all the bioinformatics tools required to analyze RNA-seq gene expression data, from the raw data to the biological interpretation.This two-day course will discuss the following topics:
- Quality control and reads cleanup
- RNAseq reads mapping to genome & transcriptome
- Gene reads counting, gene & exons differential experession
- Transcriptome reconstruction, transcript quantification & transcript DE
Learning objectives
At the end of the course attendees will:
- Understand advantages and pitfalls for RNA sequencing
- Be able to design their own experiment
- Practise the downstream analysis using command line software (QC, mapping, counting, Diff Expression, gene enrichment, pathway analysis)
Prerequisites
Knowledge / competencies:
- Participants should already have a basic knowledge of Next Generation Sequencing (NGS) techniques or already followed the Introduction to NGS course; this course will discuss only the data analysis steps and not the data generation.
- A basic knowledge of the R statistical software is also required.
Technical: Participants should bring their laptop (mininum 4GB RAM and 30 GB of free hard disk space) with R, Virtualbox software installed and the NGS_VM.ova virtual image deployed (more tech information and the 'NGS_VM.ova' will follow by the 5th of Feb).
Application
The course is full.
The registration fees for academics are 100 CHF. This includes course content material and coffee breaks. Participants from non-academic institutions should contact us before applying.
Deadline for application and free-of-charge cancellation is set to 4 February 2016. Cancellation after this date will not be reimbursed. Please note that participation to SIB courses is subject to our general conditions.
Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Location
Nr. 215 / 2. OG West - Universität Bern, Hochschulstrasse 4
Additional information
Coordination: Diana Marek - SIB Training and Outreach
You are welcome to register to the SIB courses mailing-list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
For more information, please contact training@sib.swiss.
Schedule
Monday 15 February
9:15 - 10:30: Introduction to RNA-sequencing
- Experimental design: challenges, considerations, strategies
- Examples
10:30 - 11:00: Coffee break
11:00 - 12:30: Sequencing archives, SRA, ENA and DDBJ
- Practicals using SRA-tools
- File format - Quality Control - subsetting
12:30 - 13:30: Lunch break
13:30 - 15:00: Alignment to a reference genome/transcriptome
- TopHat
- STAR
15:00 - 15:30: Coffee break
15:30 - 17:00: RPKM/FPKM (Reads/Fragments Per Kilobase of transcript per Million mapped reads) Vs. Read counts
- Practicals "htseq"
Tuesday 16 February
9:00 - 10:30: Expression quantification
- FPKM (Fragments Per Kilobase Of Exon Per Million fragments mapped) vs. Counting mapped fragments
- Practicals using htseq-count
10:30 - 11:00: Coffee break
11:00: 12:30: Differential expression
- Practicals using DESeq2 (R-statistics)
12:30 - 13:30: Lunch break
13:30 - 15:00: Gene Ontology and GO enrichment analysis
- Practicals using Goseq (R-statistics)
15:00 - 15:30: Coffee break
15:30 - 17:00: Differentially enriched Pathways finding
- Practicals using Pathview (R-statistics)
17:00- 17:30: Optional exam